Language Exercises

1a. I found this half of the exercise to be much easier than the second. I did this exercise with my fiancée, who knows American Sign Language and has taught me some, so communicating without words is not new to us. However, it was difficult to resist the urge to use what I know of ASL to communicate more efficiently, instead of just using general motions and facial expressions.

1b. She was taken aback by the proposal of the exercise but once we were underway she was instantly comfortable. She did not have to change how she communicated with me at all since she knows how to communicate with deaf people. She had no issue translating my gestures and my expressions into what they truly were—we think on the exact same wavelength very often, as if our brains were telepathically connected, and this is where I think communicating with her gave me a slight edge in this exercise.

1c. It is definitely more advantageous to be able to communicate in a more complex form of symbols. Simply using arbitrary motions and expressions are very vague, and even though a culture that does not speak a certain language may not understand exactly what the “spoken-language” person is communicating, having a more specified vocabulary ultimately makes it easier to communicate precisely.

A speaking culture may be taken aback by a culture that has not adapted toward speaking. As a person from a speaking culture, it seems so inefficient to communicate without speech (assuming efficiency is the ultimate goal, here). However, there are definite situations where it is advantageous to communicate without having to use sounds, like when a group is hunting or during a covert operation mission.

The easiest example to give for people who have difficulty communicating with spoken language is deaf or partially deaf people. Fully deaf individuals, especially if they were deaf from birth, can find it very frustrating to try to understand someone who only knows how to speak a language. Trying to use sign language with someone who has no idea what the symbols mean can be taxing if both parties are not patient. I know barely any ASL myself, and what I do know did take quite some time and repetition to understand.

2a. For the most part, I was actually able to complete this exercise. There was only one point at which I really let it go and broke “character.” However, there were quite a few times where I was making an interrogative statement and inflected my voice. This is one of the things that is very hard not to do. This exercise was much more difficult for me because I felt like I was incredibly restricted, as if I were imprisoned within myself. Having to keep a straight facial expression and speak in a monotone voice was incredibly annoying and irritating for me.

2b. Again, she did not have too much trouble trying to figure out how to communicate with me. This time she just had to stop and pause every time I was talking because I was trying to pronounce every syllable of every word in the exact same tone so as not to waver from the non-expressive state. Also, the times I would ask an interrogative question and successfully mask any inflection, she would have to repeat the phrase or statement back to me using her own inflection to acquire affirmation that it was or wasn’t actually interrogative. I also noticed that, through the “freezing” of my facial expression, her facial expression varied much less than it normally does. She is a very expressive person and I think she was subconsciously imitating my stone-face as a sympathetic response to that me in my restricted state.

2c. As the old adage goes, you don’t know what you have until it’s gone. Once I was restricted from making facial expressions, shrugging, or varying my vocal tones I realized how truly dynamic the communication process is. This really is something that we don’t talk pr think about too much but the use of non-verbal communication is just as, if not more, important that verbal communication. Facial expressions and body language are very telling signs for the emotions behind words and phrases, and understanding the feelings behind words and phrases in communication definitely gives more depth and understanding to what exactly one is trying to say. It is certainly possible to communicate solely using a monotone voice, but it is difficult to ascertain whether or not someone is asking a question or giving a command, etc. This can be demonstrated in written language by taking away punctuation and capitalization—if all of the letters are lower/upper case and there is no punctuation separating the words and phrases, do you really know what exactly the author is trying to say? It takes much more work to figure that out.

2d. Blind people would be an obvious selection for people who cannot read body language. Also, I imagine that anyone who would be raised in an incredibly dark environment or an environment where they only communicated with other humans in different rooms from them (e.g.: a prison) would also have difficulty understanding body language.

An adaptive benefit to body language is the understanding of the emotion and physical intention (if any) underlying the message itself. If my fiancée were mourning but could only communicate to me with a monotone voice, it would be difficult to actually believe that she was sad about something; but with nonverbal communication, she could hang her shoulders and make a devastated face, which clarifies what exactly the words are trying to express. Also, if someone is being aggressive, one would not be able to discern that solely from a monotone voice, but from tension, stance, and the actual inflections of the voice.

The only sort of situation I can think of is one where it is beneficial to know less than to know more—possibly some sort of secret meeting where the information is life-threatening, knowing less might actually cause someone to live longer. It is difficult to imagine a circumstance where knowing less is beneficial because throughout my whole life it seems that more knowledge and clarity have always been positive, and the converse—obscurity and ignorance—seem the negative.

The Piltdown Man Hoax

1. The Piltdown Hoax was an event in the early 20^th century where fossils were discovered in a gravel pit in Piltdown, East Sussex, England. These fossils were allegedly the fossils belonging to the previously unknown early human. The one man most responsible for making this discovery was Charles Dawson. This was monumental in that time for the development of evolutionary theory because the Piltdown Man was believed to be the missing link between apes and humans in the fossil record. Evidence arose after Dawson’s death that revealed this discovery to be hoax and the fossils to be false. This is highly unfortunate for that time because much other real fossil evidence was overlooked in light of the Piltdown findings, effectively leading evolutionary study down a fake trail that exposed the vulnerability of honest scientists.

The excitement that surrounded such a monumental discovery could have been one of the main reasons there was no intense scrutiny of the find in the years following the discovery. However, once the scientific community decided to test the veracity of the find, they found that the bones were from three different species (human skull fragments, an orangutan jaw, and a chimpanzee tooth) that had been dyed and modified by filing and other methods. The scientific community was obviously not thrilled about the truth of the Piltdown finds, and they realized that there is now the possibility for someone to come into their community of honesty with lies and deception—something that had not been experienced before. Scientists were known to be eager minds searching for more and this event exposed the fault of human desire misplaced.

2. The human faults that came into play in the Piltdown findings were one man’s (or group’s) desire to elevate himself or his own discovery to the upper echelons of recognition, instead of working diligently to advance the science itself. This fault hurt the advancement of evolutionary study because it was a lie that led the whole community down a trail with a dead end. Humans can at times be incredibly selfish, desiring only to be famous or otherwise, and the scientific community was not invincible to such pitfalls.

3. The positive aspect of the scientific process that revealed the fossils to be false was testing. Peer review has always been one of the most foolproof ways that the scientific community has verified the work of peers in order to discover truth through science instead of arriving at bogus conclusions, like those drawn from the Piltdown fossils. Once skeptic scientists finally got their hands on the Piltdown fossils in order to apply advanced dating techniques unlike those present at the discovery of the fossils, the fakes were found to be mere centuries old—not hundreds of thousands or a million as purported by initial reports.

4. It is never truly possible to remove the “human” element from something that is exclusively done by humans. The scientific process is also somewhat predicated on the human desire to discover more about the world in which we live. Despite the whole of scientific study coming so far in recent history, it seems to be that the more we know, the more we understand we know almost nothing, and we drive towards knowing even more. The competitive element that drives some humans to lie and cheat other honest people exists almost everywhere and one of the best ways to combat this is already built into the scientific process—peer review. Having your peers check your work for you, especially those with no ties to you, is one of the best ways to insure that your work is legitimate. Your peers will be less biased towards the conclusions because they do not have any stake in the study being true; they will be able to see faults that you yourself cannot sometimes see. So, then, overall, the human element may never be removed from the scientific process, but I am not entirely sure if that is even a bad thing.

5. From this event, we can learn that we should be skeptic of information from unknown sources. Even if we are in what seems to be an honest circle of people, there remains the possibility for someone to want to get ahead and lie to get there. For any source that is unknown or unfamiliar it is always best to determine the ethos of the source and whether or not it can be trusted. If the source is not credentialed in the field they are speaking into, or are unrecognized by the majority of credible scholars, it might be wise to search for information elsewhere, no matter how tempting it may be to accept. Even for sources of information that are marginally recognized by a community, it is still wise to make sure that this source is actually doing legitimate work, and not working towards advancing a personal perspective, e.g.: only publishing information that drives towards this perspective. 

Primate Traits

1. Primate Environments

1a. Lemurs—formerly occupying other tropical regions on the earth, these primates have been confined to only the island of Madagascar and nearby Comoro Islands. Lemurs live in forests on Madagascar ranging from rainforest type regions to dry deciduous forests.

1b. Spider monkeys—these are arboreal primates that thrive in the upper canopy, which allows them isolation from competition. Sometimes they occupy deciduous and mangrove forests.

1c. Baboon—Baboons are highly adaptable primates capable of living in a wide variety of environments including savannahs, open grasslands, evergreen forests, and gallery forests.

1d. Gibbon—these primates live in tropical hill forests, often found about 1000 ft. They are also found to inhabit lowland forests, selectively logged primary freshwater swamp forests, selectively logged lowland forests, selectively logged hill forests, and submontane forests.

1e. Chimpanzee—Chimps are another highly adaptable primate and live in a wide variety of environments. Their habitats include dry savannahs, evergreen rainforests, montane forests, swamp forests, and dry-woodland savannah mosaics. 

2. Body Size and Sexual Dimorphism

            2a. Lemurs—There is some sexual dichromatism between some male and female lemurs. For the most part, there is not really any distinguishable size difference between the sexes.

            2b. Spider monkeys—As with lemurs, there is not much distinguishable dimorphism here. However, female spider monkeys do have a very slightly lower average size than males; aside from this, they are mostly similar.

            2c. Baboon—These primates show distinct sexual dimorphism. Males can often be up to two times as large as females, and there are distinct facial features—in dental structure, especially relating to the canines, as well as skull size.

            2d. Gibbon—Dimorphism for gibbons is less distinct, but existent. There are slight size differences, with males being slightly larger than females, but there are fur color differences in many species between the sexes.

            2e. Chimpanzee—Chimpanzees exhibit an average amount of dimorphism, with fully-grown females being about 25% smaller and about 15-20% shorter than fully-grown males.

3. Body Size and Sexual Dimorphism as an Environmental Adaptation

            3a. Lemurs—Given such a restricted environmental diversity, it is not surprising to see limited sexual dimorphism here. The dimorphism present in the fur colors could be related to sexual attraction, with more colored lemurs being more attractive. It could also serve as a sort of camouflage in different environments since lemurs are so small and vulnerable to predation.

            3b. Spider monkeys—Again we can see that restricted environment diversity is also paired with limited sexual dimorphism. The slight size differences between males and females could be from a slight difference in daily activities (if males hunt/gather more) or, again, sexual attraction (females being attracted to bigger males/males being attracted to smaller females).

            3c. Baboon—The sexual dimorphism is very prominent. With males being so much larger on average, as well as having distinct coloration, these could definitely be tied to sexual attraction. I would hypothesize, however, that given that their environments are less in the trees and more on the ground, there is little that these primates can do to escape each other if challenged. The more prominent canines in males could also be adapted to exude dominance. If one were to examine social behaviors and find that baboons are known to fight with each other over mates, food, living areas, etc., then these differences in size and color could be adapted by males bearing these traits (larger, more colorful, bigger teeth) winning challenges more often.

            3d. Gibbon—These only have slight expressions of dimorphism, though more than lemurs and spider monkeys, and their environments are also more varied. However, even though gibbons do live across more of the environmental spectrum, they are arboreal. Fur differences have been linked to sexual readiness or adequacy, and size may be linked to males needing to hunt/gather more than females.

            3e. Chimpanzee—Since chimps live across a wider variety of environments than gibbons, it is once again not very surprising to find a higher exhibition of sexual dimorphism. Males are distinctly larger and taller than females, though there are no notable differences in color. This size difference can be adapted to males hunting/gathering more than females, who would have to care for their young since they are placental mammals and bear their offspring before birth, essentially being hindered to compete for food.

4. In summary, I found that, in general, the more varied these primate’s environmental habitats were the more sexual dimorphism would be present in current species. This is a generalization, of course, because we see that baboons have what seems to be an extreme case of dimorphism. Regardless of how their traits adapted in the first place, they are present today and can be noted as clear evidence of an environment having a diverse effect even within a single species. Environmental effects do not have to be limited to sexual dimorphism, though. Spider monkeys, being arboreal, have tails that have adapted to function somewhat like a fifth hand or limb, with a furless tip that can hold on to and grip tree branches.

Lemurs

Spider Monkeys

 Baboons

Gibbons

Chimpanzees

Homologous and Analogous Strucutres

1a) The trait I have chosen is the mammalian forelimb. Two species in particular would be human beings, who are land-dwelling, upright bipeds, and sea lions, which are a marine, and thus swimmer, species (though they can surface for periods of time).

1b) The human forelimb has an extended humerus as compared to the sea lion, as well as a longer ulna. Carpal structure is also similar, but the metacarpals and phalanges of humans are relatively short, however separated. The sea lion metacarpals and phalanges appear to be longer but connected and to function more as a whole unit, as opposed to the human digits that can function independently of the others.

These traits exhibit differences between the two species because of the environments in which the species evolved. Though there is a similar ancestor, human beings ultimately ended up on land and walking upright led us to find uses for our hands. Sea lions use their forelimbs are flippers that propel them through water. The different environmental pressures drove the two different forelimbs to evolve to serve two different, but similar, purposes.

 

1c) A common ancestor between sea lions and humans would have been a placental mammal that was probably a quadruped that lived either by land or sea. The mammalian forelimb was present in some of the oldest known mammals (up to around 200 mya) and was likely a feature that evolved differently after different speciation events. The latest common ancestor between sea lions and humans would have been around 80-100 mya.

2a) The analogous trait I have chosen is the eye. Two species that posses eyes but have no homologous relation are humans and octopuses. Humans, again, are land dwelling creatures, octopi are marine creatures.

2b) Both eye structures have an eyelid, a cornea, a pupil, and a lens that focuses the light onto the retinal cells coating the rear of the eye. There are also receptor cells, also on the rear of the eye, that collect and send this information via the optic nerve, again at the rear of the eye structure. There are similarities between these structures because both of these species adapted to the benefits of being able to see (process light information). Primitive photosensitive structures on ancestors of either species likely mutated slowly in order to see clearly (somewhat) in varying conditions.

2c) Given that the last common ancestor between humans and octopuses lived hundreds of millions of years ago, it is unlikely that a common ancestor would have had eyes. This time period contains some of the most primitive animals, and eye structures are some of the most complex evolved structures known to biology. It is possible that basic photosensitive structures existed on the earliest animals, but nothing close to an eye.

DNA Code

GGATGTACAAGCACGGGACCGTTACAACCGTAATCCGGTGATGTC

Enjoy!

Uniformitarianism and Natural Selection

Charles Lyell

   1. Charles Lyell was a contemporary (1797-1875) and friend of Charles Darwin. He began his education as a lawyer but switched his interest toward geology and is now considered the founder of modern geology. His developments in geology are recognized now as the theory of uniformitarianism.

   2. Uniformitarianism is somewhat of a response over and against the reigning hypothesis of its day- catastrophism. What catastrophism asserted was essentially that the geological forces that shaped the earth were much more 'catastrophic' in earlier history than they were in modern times, and most proponents of this view sought to explain it with stories like the flood of Noah from the Judeo-Christian Bible. However, Lyell was not convinced and developed uniformitarianism which essentially was his assertion that the geological forces that are seen in the modern day, such as erosion from water and wind, are quite similar to those that would have been shaping the earth throughout its history. Consequently, this also led him to the conclusion that the earth must be incredibly old- much older than 'catastrophists' would say- because these less catastrophic forces take far longer to create such changes as valleys and mountains (rather than, lets say, a meteor strike).

   3. Being friends with Darwin, Charles' work certainly impacted Darwin's study. The point from the list that I would say most closely correlates with Lyell's work is "Individuals do not evolve.  Populations do." What I construe from this is that there is no specific change within any given individual organism and changes must occur over more than one reproductive cycle. Given that Darwin thought that adaptation must occur over longer periods of time, he may have gained this insight from Lyell's conclusions of an older earth. Also, given that Darwin spent much of his time studying in tropical climates, he could have known that sea turtles live very long lives, and for any positive adaptable traits to be passed down there would have to be numerous mating cycles for any significant part of the population to posses those traits.

  4. I think that Darwin certainly could have developed his theory of natural selection without the influence of Lyell, though it may have taken him much longer to come to the conclusions of natural selection regarding time span. Nevertheless, given the sea turtle example from above, I think he could have come to the same conclusion through a different manner.

   5. A major stumbling block of catastrophism Darwin's day (and arguably our own) is the belief that all of the earth's current organisms were created in their current form and had no origin but that of the divine. Darwin's conclusions were quite contrary to this and he encountered much friction in his attempts to publish. In fact, it took him quite a long time to finally publish his ideas after he had taken his initial voyage aboard the Beagle.

Sources Cited

http://www.britannica.com/EBchecked/topic/352672/Sir-Charles-Lyell-Baronet/4377/New-approach-to-geology

http://www.macroevolution.net/charles-lyell.html#.UIoiBMXA9fY

http://evolution.berkeley.edu/evolibrary/article/history_12